 |
The following primer pair is found for 146135021c1
| Gene Descriptions: |
| NCBI GeneID |
67427 |
| GenBank Accession |
NM_026147 |
| NCBI Protein Accession |
NP_080423 |
| Species |
Mouse |
| Coding DNA Length |
360 |
| Gene Description |
Mus musculus ribosomal protein S20 (Rps20), mRNA. |
| Primer Pair Descriptions: |
| PrimerBank ID |
146135021c1 |
| Amplicon Size |
77 |
|
Sequence (5' -> 3') |
Length |
Tm |
Location |
| Forward Primer |
CCCGAAGTGGCGATTCACC |
19 |
63.0 |
37-55 |
| Reverse Primer |
TCCGCACAAACCTTCTCCAG |
20 |
62.1 |
113-94 |
| Location in Coding Sequence (primers and amplicon highlighted) |
1 atggcattta aagataccgg aaagacgccc gtggagcccg aagtggcgat tcaccgaatt
61 cgaatcacgc tcaccagccg caacgtgaag tcgctggaga aggtttgtgc ggacttgatc
121 agaggcgcca aggaaaagaa tctgaaagtg aaaggaccgg tgcgcatgcc taccaagact
181 ttgagaatca ctaccagaaa aacaccttgt ggtgaaggtt ccaagacctg ggatcgattc
241 cagatgagga tccacaagcg actcattgat ttacatagtc cttctgagat tgttaagcag
301 attacttcca tcagtattga gccgggagtt gaggttgaag tcaccattgc agatgcctaa |
|
