 |
The following primer pair is found for 34304069a1
| Gene Descriptions: |
| GenBank Accession |
AK002886 |
| NCBI Protein Accession |
BAC25011 |
| Species |
Mouse |
| Coding DNA Length |
330 |
| Gene Description |
Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610041G09 product:actin, alpha 2, smooth muscle, aorta, full insert sequence. |
| Primer Pair Descriptions: |
| PrimerBank ID |
34304069a1 |
Validation Results (Click here to view experimental validation data: amplification plots, dissociation curves, 2% agarose gel analysis, sequencing and BLAST data) |
| Amplicon Size |
170 |
|
Sequence (5' -> 3') |
Length |
Tm |
Location |
| Forward Primer |
CCCAACTGGGACCACATGG |
19 |
62.3 |
100-118 |
| Reverse Primer |
TACATGCGGGGGACATTGAAG |
21 |
62.2 |
269-249 |
| Location in Coding Sequence (primers and amplicon highlighted) |
1 atggttggaa tgggccaaaa agacagctat gtgggggatg aagcccagag caagagaggg
61 atcccgaccc tgaagtatcc catagaacac cgcctcctcc ccaactggga ccacatggaa
121 aagatctggg accacccctt ccataacgag cctcctgtgg cccccgaaga gcctcccaca
181 ccgccgacag aggcccccct gaaccccaag ggccaacggg agaaaatgac ccagattatg
241 tttgagacct tcaatgtccc ccgcatgtat gtggccattt cggctgtgcc gttcccctat
301 gctctggacc gtaaaatggt attgtgctga |
|
